Gene name |
SPBC646.10c |
Gene ID |
24/B06 |
Gene synonyms/obsolete |
|
Gene product |
ribonucleoprotein
(RNP) complex; processome component; involved in rRNA
processing; snoRNA binding domain; U3 snoRNP component; C/D
box snoRNP component; involved in 2'-O-methylation of
rRNAs |
Entry clone |
Cloned |
ORF length (unspliced) |
1494 |
ORF length (spliced) |
|
Entry clone length |
1494 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
485A:G / 1228T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC646.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGATTACTTGTTGTA |
Rev primer name |
SPBC646.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGGCTCTTCTTTTTCTTC |
Amino acid length |
497 |
Molecular weight |
55.3 |
Isoelectric point (calc.) |
9.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
474/475/459/492 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNDFLKNFLEL |
Localization (YFP) |
nucleolus>>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleolus>nucleus |
Microscope used for
observation |
DeltaVision |