| Gene name |
SPBC902.05c |
| Gene ID |
24/B05 |
| Gene synonyms/obsolete |
idh2; glu2 |
| Gene product |
isocitrate
dehydrogenase (NAD+); non-essential; involved in tricarboxylic
acid cycle; involved in isocitrate metabolism; involved in
glutamate biosynthesis; isocitrate dehydrogenase (NAD+)
activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1494 |
| ORF length (spliced) |
1137 |
| Entry clone length |
1494 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
822A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC902.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAATGCTTTCTACTTT |
| Rev primer name |
SPBC902.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTCAGTTTAGAAATAATG |
| Amino acid length |
378 |
| Molecular weight |
41 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |