Gene name |
SPBC1773.15 |
Gene ID |
24/B04 |
Gene synonyms/obsolete |
|
Gene product |
membrane transporter;
unknown specificity; allantoate permease family; similar to Sp
SPCC757.13 and SPCC417.10 |
Entry clone |
Cloned |
ORF length (unspliced) |
1494 |
ORF length (spliced) |
|
Entry clone length |
1494 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
975T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1773.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGAAGACAGAAGAAGA |
Rev primer name |
SPBC1773.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATAGAATAACGAAATTCG |
Amino acid length |
497 |
Molecular weight |
56 |
Isoelectric point (calc.) |
8.8 |
Signal SEQ |
|
No. of transmembrane domain |
10 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWVMPLLCL/LGFMVFSLPL |
Localization (YFP) |
Golgi; periphery at
cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |