| Gene name |
SPBC2D10.13 |
| Gene ID |
24/E07 |
| Gene synonyms/obsolete |
est1 |
| Gene product |
TPR repeat protein;
EST1 domain; involved in telomere maintenance; involved in
telomerase-dependent telomere maintenance; involved in
telomerase regulation; involved in transcriptional silencing;
similar to Sp SPBC2F12.03c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1514 |
| ORF length (spliced) |
1473 |
| Entry clone length |
1514 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1312A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2D10.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGCAACAACTTTCAAG |
| Rev primer name |
SPBC2D10.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAAAGCAATAAATTTAGT |
| Amino acid length |
490 |
| Molecular weight |
57.2 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB?; nucleus |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |