| Gene name |
SPAC29A4.02c |
| Gene ID |
24/F12 |
| Gene synonyms/obsolete |
tef3 |
| Gene product |
elongation factor 1
(gamma subunit) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1523 |
| ORF length (spliced) |
1230 |
| Entry clone length |
1523 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
86T:C / 340T:deletion
/ 892C:T / 1505C:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC29A4.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGTAGGAACCGTTTA |
| Rev primer name |
SPAC29A4.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGCAGACCTTGCCGTCA |
| Amino acid length |
409 |
| Molecular weight |
45.7 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKFIDQPLPI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |