Gene name |
SPAC1296.03c |
Gene ID |
24/G01 |
Gene synonyms/obsolete |
sxa2 |
Gene product |
serine
carboxypeptidase; involved in conjugationdegrades
extracellular P-factor; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1524 |
ORF length (spliced) |
|
Entry clone length |
1524 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
153A:G / 282T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1296.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTGTCTTTATTTTTGAA |
Rev primer name |
SPAC1296.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAAAGCAACGTATTTTCA |
Amino acid length |
507 |
Molecular weight |
56.6 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFAIIIIELTI |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |