| Gene name |
SPCC417.10 |
| Gene ID |
24/G09 |
| Gene synonyms/obsolete |
|
| Gene product |
membrane transporter;
unknown specificity; allantoate permease family; similar to Sp
SPCC757.13 and SPBC1773.15 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1527 |
| ORF length (spliced) |
|
| Entry clone length |
1527 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
86T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC417.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAGCATCAGTATAGA |
| Rev primer name |
SPCC417.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAAGTGTATCTGAAATCA |
| Amino acid length |
508 |
| Molecular weight |
56.6 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVFEFPASLLL/LSKTLCVFLVI/LIFIICGVLAI/LIAFGFLSL |
| Localization (YFP) |
Golgi; periphery at
cell tip and site of septum formation; ER? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |