Gene name |
SPAC30D11.06c |
Gene ID |
25/A08 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; eukaryotic conserved protein; DUF300 |
Entry clone |
Cloned |
ORF length (unspliced) |
1544 |
ORF length (spliced) |
1281 |
Entry clone length |
1544 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1087T:C /
1094T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC30D11.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACAACGAAATAGTCGC |
Rev primer name |
SPAC30D11.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGTATATGAAGAAGATGCA |
Amino acid length |
426 |
Molecular weight |
49.2 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
5 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYCFFCLLI/LVYNISITLSL |
Localization (YFP) |
vacuole membrane |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |