| Gene name |
SPBC2G2.11 |
| Gene ID |
25/D04 |
| Gene synonyms/obsolete |
|
| Gene product |
glycylpeptide
N-tetradecanoyltransferase; involved in N-terminal protein
myristoylation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1577 |
| ORF length (spliced) |
1401 |
| Entry clone length |
1577 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
462A:G / 878G:A /
1064T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2G2.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACAACGAAAATAATAA |
| Rev primer name |
SPBC2G2.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATCATTACAAAACCCATT |
| Amino acid length |
466 |
| Molecular weight |
53.6 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |