| Gene name |
SPBC36.09 |
| Gene ID |
25/E08 |
| Gene synonyms/obsolete |
sap61 |
| Gene product |
zinc finger protein;
zf-C2H2 type; RNA-binding protein; complexed with Cdc5p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1586 |
| ORF length (spliced) |
1479 |
| Entry clone length |
1586 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC36.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGAAAGCGTGCTCGA |
| Rev primer name |
SPBC36.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATAAACCTTGGGCCTTT |
| Amino acid length |
492 |
| Molecular weight |
57.2 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |