Gene name |
SPAC4D7.08c |
Gene ID |
25/F11 |
Gene synonyms/obsolete |
ade4; min13;
aza1 |
Gene product |
amidophosphoribosyltransferase; glutamine
phosphoribosylpyrophosphate amidotransferase; involved in
purine biosynthesis; purine nucleotide de-novo biosynthetic
pathway; involved in glutamate metabolism; expression not
repressed by ade4 |
Entry clone |
Cloned |
ORF length (unspliced) |
1602 |
ORF length (spliced) |
|
Entry clone length |
1602 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1426T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4D7.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGCGGAATTTTGGCGTT |
Rev primer name |
SPAC4D7.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACAAAATCAAAAGTAACA |
Amino acid length |
533 |
Molecular weight |
59.8 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots;
faint filamentous structures |
Comments for localization |
bright dots by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |