| Gene name |
SPBC3F6.06c |
| Gene ID |
26/A04 |
| Gene synonyms/obsolete |
SPBC342.01c |
| Gene product |
glycosyl transferase
family ALG8 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1627 |
| ORF length (spliced) |
1521 |
| Entry clone length |
1627 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
509T:C / 1394T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3F6.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTATCTGAGTTTGAGAA |
| Rev primer name |
SPBC3F6.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCTTCTTTTTTGTTACGC |
| Amino acid length |
506 |
| Molecular weight |
59.2 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWTLGRLLHI |
| Localization (YFP) |
Golgi; vacuole
membrane |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |