| Gene name |
SPAP7G5.02c |
| Gene ID |
26/C07 |
| Gene synonyms/obsolete |
|
| Gene product |
GMP synthase
[glutamine-hydrolyzing]; involved in purine biosynthesis;
involved in guanine biosynthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1863 |
| ORF length (spliced) |
1620 |
| Entry clone length |
1863 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
436A:G / 727T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAP7G5.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTCCACTGAAGTGCC |
| Rev primer name |
SPAP7G5.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCCATTTCGACAGTTGCC |
| Amino acid length |
539 |
| Molecular weight |
60 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol, partially |
| Microscope used for
observation |
DeltaVision |