| Gene name |
SPBC3B9.03 |
| Gene ID |
26/E12 |
| Gene synonyms/obsolete |
SPBC3B9.02b |
| Gene product |
G-patch domain;
complexed with Cdc5p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1900 |
| ORF length (spliced) |
1644 |
| Entry clone length |
1900 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
500G:A / 1388A:G /
1434T:C |
| Comments |
Registered as
SPBC3B9.02 in GenBank. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3B9.02b.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTGACTTGTTTGCGAT |
| Rev primer name |
SPBC3B9.02b.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTCATCAGTTGATCAACT |
| Amino acid length |
547 |
| Molecular weight |
61 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |