| Gene name |
SPAC6F6.03c |
| Gene ID |
27/E06 |
| Gene synonyms/obsolete |
|
| Gene product |
GTP-binding protein
associated; localization nucleus; part of a pre-60S complex
(SGD) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2018 |
| ORF length (spliced) |
1614 |
| Entry clone length |
2018 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1129T:C / 1672T:C /
1745G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F6.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCACCTATAAGAAAGA |
| Rev primer name |
SPAC6F6.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTCCTATTCTTATTATCA |
| Amino acid length |
537 |
| Molecular weight |
59.9 |
| Isoelectric point (calc.) |
9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB?; dots on spindle
microtubules; nucleus |
| Comments for localization |
anaphase SPB? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |