| Gene name |
SPCC23B6.01c |
| Gene ID |
27/E09 |
| Gene synonyms/obsolete |
|
| Gene product |
oxysterol binding
protein; involved in ergosterol biosynthesis; similar to Sp
SPBC646.08c and SPBC354.07c and SPBC1271.12 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2025 |
| ORF length (spliced) |
1470 |
| Entry clone length |
2025 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
365A:G / 501G:A /
1288T:C / 1832A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC23B6.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGAAATGGGAAATTGC |
| Rev primer name |
SPCC23B6.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAAGCTGGATCCTGTTCT |
| Amino acid length |
489 |
| Molecular weight |
55.8 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|