| Gene name |
SPAC6F12.14 |
| Gene ID |
27/E10 |
| Gene synonyms/obsolete |
cut23; apc8 |
| Gene product |
anaphase-promoting
complex (APC); cyclosome; TPR repeat protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2028 |
| ORF length (spliced) |
1698 |
| Entry clone length |
2028 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
552A:G / 1960T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F12.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGTGTCGCTGAATAC |
| Rev primer name |
SPAC6F12.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATATGAATGCTCCATC |
| Amino acid length |
565 |
| Molecular weight |
65.8 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSEVLNGDLEL |
| Localization (YFP) |
SPB?; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |