| Gene name |
SPAC23C11.16 |
| Gene ID |
27/F06 |
| Gene synonyms/obsolete |
plo1 |
| Gene product |
Polo kinase Plo1;
essential; serine/threonine protein kinase; involved in
spindle formation, contractile ring assembly, contractile ring
positioning, septation; functional homolog of Sc CDC5;
interacts physically with Cut12p; stress response pathway
signalling (SRP), mediated phosphorylation of Ser402 regulates
the timing of commitment to mitosis; stress response pathway
signalling (SRP), mediated phosphorylation of Ser402 ensures
efficient reinitiaion of tip growth and cell division during
recovery from particular stress; function depends on
recruitment to the spindle pole body; function depends on a
functional spindle assembly checkpoint; function
(localization) depends on Polo boxes; regulator of MPF
complex; regulator of transcription at M-G1 interval;
regulated by PBF transcription complex; expression peaks at
M-G1 phase; transcriptionally regulated by Sep1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2052 |
| ORF length (spliced) |
|
| Entry clone length |
2052 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
392A:G / 1158A:G /
2002T:A / 2033C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23C11.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGAGTGTTGCAATTAA |
| Rev primer name |
SPAC23C11.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTCACTTCCATTTTCGAC |
| Amino acid length |
683 |
| Molecular weight |
77.3 |
| Isoelectric point (calc.) |
9.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; cytosol;
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |