Gene name |
SPBC13G1.05 |
Gene ID |
27/H12 |
Gene synonyms/obsolete |
|
Gene product |
conserved eukaryotic
protein |
Entry clone |
Cloned |
ORF length (unspliced) |
2113 |
ORF length (spliced) |
1950 |
Entry clone length |
2113 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
591T:C / 1479A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC13G1.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAGCAATACCTCACC |
Rev primer name |
SPBC13G1.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCAAATTCTTTTAGAATGC |
Amino acid length |
649 |
Molecular weight |
74.7 |
Isoelectric point (calc.) |
9.8 |
Signal SEQ |
|
No. of transmembrane domain |
3 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAYMVLHTLVL/LFFMAIMLKL |
Localization (YFP) |
ER; Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |