Gene name |
SPAC3G9.05 |
Gene ID |
28/A01 |
Gene synonyms/obsolete |
|
Gene product |
GIT repeat protein
(SMART); ADP-ribosylation factor; GTPase-activating protein;
involved in cell polarity; involved in conjugation; involved
in conjugation with cellular fusion; predicted coided-coil
region |
Entry clone |
Cloned |
ORF length (unspliced) |
2114 |
ORF length (spliced) |
1980 |
Entry clone length |
2114 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
1856T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3G9.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAAGTATTATTATTCG |
Rev primer name |
SPAC3G9.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACGGGTGGAGAATTGTGTC |
Amino acid length |
659 |
Molecular weight |
73.8 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFDVSSPLEL |
Localization (YFP) |
periphery at cell tip
and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |