| Gene name |
SPCC1235.10c |
| Gene ID |
29/B04 |
| Gene synonyms/obsolete |
sec6 |
| Gene product |
involved in secretory
pathway; involved in exocytosis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2508 |
| ORF length (spliced) |
2193 |
| Entry clone length |
2508 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
118T:C / 231A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1235.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCGCTGCCGCATCGGA |
| Rev primer name |
SPCC1235.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAAATTGAACTTCCAGAA |
| Amino acid length |
730 |
| Molecular weight |
83.3 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSDNFDRLVL |
| Localization (YFP) |
SPB; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |