Gene name |
SPAC139.01c |
Gene ID |
29/B05 |
Gene synonyms/obsolete |
SPAC955.02c |
Gene product |
XP-G family; involved
in nucleotide-excision repair; involved in DNA repair |
Entry clone |
Cloned |
ORF length (unspliced) |
2510 |
ORF length (spliced) |
2409 |
Entry clone length |
2510 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
514r:a / 1346T:C /
1368T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC139.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAAGTAAGTTAAAATA |
Rev primer name |
SPAC139.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAGCCAAGAGAAAATATC |
Amino acid length |
802 |
Molecular weight |
90.1 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAKVATFLPI |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |