Gene name |
SPAC4F8.11 |
Gene ID |
29/C10 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; WD repeat protein; similar to human peroxisomal
targeting signal receptor; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
2541 |
ORF length (spliced) |
|
Entry clone length |
2541 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
258A:G / 548T:C /
2225T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC4F8.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTCACGAAACTCAAA |
Rev primer name |
SPAC4F8.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATCAGAGCACGTTTATCT |
Amino acid length |
846 |
Molecular weight |
93.2 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKCVYCELPL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
Microscope used for
observation |
Leica |