| Gene name |
SPBC1347.01c |
| Gene ID |
29/E01 |
| Gene synonyms/obsolete |
SPBC215.16c |
| Gene product |
deoxycytidyl
transferase; involved in DNA repair; involved in mutagenic
translesion DNA replication; BRCT domain; impB/mucB/samB
family domain; BRCT domain |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2808 |
| ORF length (spliced) |
|
| Entry clone length |
2808 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1347.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTTTAATCAAAGGAA |
| Rev primer name |
SPBC1347.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAAATCATTAATGGAGGT |
| Amino acid length |
935 |
| Molecular weight |
106.5 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
5 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQRNIPPLMI |
| Localization (YFP) |
nucleolus>nucleus;
spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |