| Gene name |
SPCC790.02 |
| Gene ID |
29/F02 |
| Gene synonyms/obsolete |
pep3 |
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); involved
in nuclear migration (sensu Fungi); involved in cell polarity;
involved in mitochondrial morphology; clathrin domain
(inferred from context); involved in intracellular protein
transport; involved in vacuole fusion; predicted coiled-coil
region |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2850 |
| ORF length (spliced) |
2703 |
| Entry clone length |
2850 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC790.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTCTGGCCGAGGATTG |
| Rev primer name |
SPCC790.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAATCCGTCGAAAAAGGT |
| Amino acid length |
900 |
| Molecular weight |
103.7 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPKKVLALGL/LVNWLLELML |
| Localization (YFP) |
cytosol; periphery at
site of septum formation; cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>cytosol;
cytoplasmic dots) |
| Microscope used for
observation |
Leica |