| Gene name |
SPAC2F3.06c |
| Gene ID |
29/F05 |
| Gene synonyms/obsolete |
kap104 |
| Gene product |
importin beta-2
subunit (transportin); beta-karyopherin; involved in nuclear
transport of mRNA-binding proteins; HEAT repeat |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2855 |
| ORF length (spliced) |
2733 |
| Entry clone length |
2855 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
124T:deletion |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC2F3.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGGACAATCCTTGGGT |
| Rev primer name |
SPAC2F3.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACACCATACTGTGCCTGA |
| Amino acid length |
910 |
| Molecular weight |
101.7 |
| Isoelectric point (calc.) |
4.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear envelope;
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |