| Gene name |
SPBC725.06c |
| Gene ID |
30/A06 |
| Gene synonyms/obsolete |
|
| Gene product |
serine/threonine
protein kinase; similar to Sp cek1 (paralog) |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
3099 |
| ORF length (spliced) |
|
| Entry clone length |
3099 |
| No. of intron |
0 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC725.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTAATCCAGAGCAATT |
| Rev primer name |
SPBC725.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATAAATGGTAGCGATAC |
| Amino acid length |
1032 |
| Molecular weight |
120.2 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
254 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKIKGLLL |
| Localization (YFP) |
cytosol |
| Comments for localization |
cytoplasmic dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |