Gene name |
SPAC26A3.10 |
Gene ID |
30/A07 |
Gene synonyms/obsolete |
|
Gene product |
ADP-ribosylation
factor; GTPase activating protein; ArfGap domain; pleckstrin
homology domain; similar to Sp csx2; no apparent Sc ortholog
|
Entry clone |
Cloned |
ORF length (unspliced) |
3101 |
ORF length (spliced) |
2772 |
Entry clone length |
3101 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
950T:C / 3044T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC26A3.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGGAAGTGACTGTAT |
Rev primer name |
SPAC26A3.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCTTTCAAATACTTTGTA |
Amino acid length |
923 |
Molecular weight |
104.4 |
Isoelectric point (calc.) |
8.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPNLQQLNL/LELLFMNGLLL |
Localization (YFP) |
periphery at cell tip
and site of septum formation; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |