| Gene name |
SPAC1B2.01 |
| Gene ID |
30/C01 |
| Gene synonyms/obsolete |
crm1; caf2;
SPAC1805.17 |
| Gene product |
chromosome region
maintenance protein 1; importin-beta family; involved in
nuclear export; bridges the interaction between Rev and the
nuclear pore complex during nuclear export; cell
cycle-dependent expression; Leptomycin B inactivates
CRM1/exportin 1 by covalent modification at a cysteine residue
in the central conserved region; involved in nuclear export of
the small ribosomal subunit; involved in oxidative stress
response; involved in nuclear export of Sty1p and Sty1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3237 |
| ORF length (spliced) |
|
| Entry clone length |
3237 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1B2.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGGCATCCTGGCATT |
| Rev primer name |
SPAC1B2.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGTTCTTCCTCCTCCATA |
| Amino acid length |
1078 |
| Molecular weight |
123.5 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVNVIKDLLGL/LNCFPALLNI |
| Localization (YFP) |
nucleus>>cytosol; nuclear envelope |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |