| Gene name |
SPAC19A8.01c |
| Gene ID |
30/C04 |
| Gene synonyms/obsolete |
sec73; sec7c;
SPAC23H3.01 |
| Gene product |
Sec7 domain;
cytohesin-like protein; similar to Sp sec71 and sec72 and
sec74 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3249 |
| ORF length (spliced) |
|
| Entry clone length |
3249 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC19A8.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCTTCAGAATTCCTTC |
| Rev primer name |
SPAC19A8.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTATCAGAAGTAGCAGAA |
| Amino acid length |
1082 |
| Molecular weight |
122.5 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |