| Gene name |
SPBC2D10.14c |
| Gene ID |
30/H10 |
| Gene synonyms/obsolete |
myo51 |
| Gene product |
class V myosin;
involved in septation, cytokinesis, contractile ring assembly;
IQ domains; DIL domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4510 |
| ORF length (spliced) |
4416 |
| Entry clone length |
4510 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1985C:G / 2289A:G /
4156T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2D10.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTCATGCAAGATTATC |
| Rev primer name |
SPBC2D10.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATGTAGCTTTAGCCAAT |
| Amino acid length |
1471 |
| Molecular weight |
167.6 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQPNLLELTI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |