| Gene name |
SPAC56F8.02 |
| Gene ID |
30/H11 |
| Gene synonyms/obsolete |
|
| Gene product |
AMP binding enzyme;
similar to Sp SPAC22F3.04 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4554 |
| ORF length (spliced) |
|
| Entry clone length |
4554 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
934A:G / 3339T:C /
3627C:addition |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC56F8.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCAATTTCCTAATCA |
| Rev primer name |
SPAC56F8.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATACTCGCTGTGGTAAA |
| Amino acid length |
1517 |
| Molecular weight |
170.6 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSEDVPAFLFL/LSCLENLMI |
| Localization (YFP) |
spindle microtubules;
periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |