Gene name |
SPBC1711.14 |
Gene ID |
31/F03 |
Gene synonyms/obsolete |
rec15 |
Gene product |
involved in meiotic
recombination; no apparent orthologs; low complexity
protein |
Entry clone |
Cloned |
ORF length (unspliced) |
592 |
ORF length (spliced) |
543 |
Entry clone length |
592 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
219A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1711.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTATTCAGTTTCAGC |
Rev primer name |
SPBC1711.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAATCGTCATCTGCTAAG |
Amino acid length |
180 |
Molecular weight |
20.5 |
Isoelectric point (calc.) |
9.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |