Gene name |
SPBC25H2.01c |
Gene ID |
31/H02 |
Gene synonyms/obsolete |
gar1;
SPBC20F10.01 |
Gene product |
small nucleolar
ribonucleoprotein complex; involved in rRNA processing;
RNA-binding protein |
Entry clone |
Cloned |
ORF length (unspliced) |
711 |
ORF length (spliced) |
585 |
Entry clone length |
711 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC25H2.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTTTAGAGGCGGTCG |
Rev primer name |
SPBC25H2.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAATCTGCCACGGAAACCA |
Amino acid length |
194 |
Molecular weight |
20.1 |
Isoelectric point (calc.) |
11.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |