| Gene name |
SPBC24C6.07 |
| Gene ID |
31/H04 |
| Gene synonyms/obsolete |
cdc14 |
| Gene product |
SIN component;
essential; involved in septum formation; involved in septation
and cytokinesis; physical interaction with Sid1p is required
for the catalytic activity of Sid1p and the localization of
Sid1p; no apparent orthologs; conserved fungal protein |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
723 |
| ORF length (spliced) |
|
| Entry clone length |
723 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC24C6.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGATCTATTAAACAA |
| Rev primer name |
SPBC24C6.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCGAATGTTTCGTCTAAC |
| Amino acid length |
240 |
| Molecular weight |
28.1 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLHVIEGLVL |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |