| Gene name |
SPBC16E9.01c |
| Gene ID |
32/A08 |
| Gene synonyms/obsolete |
SPBP16F5.09c |
| Gene product |
hypothetical protein;
sequence orphan |
| Entry clone |
Cloned |
| ORF length (unspliced) |
888 |
| ORF length (spliced) |
|
| Entry clone length |
888 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC16E9.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATCGTCTAAAAGTCC |
| Rev primer name |
SPBC16E9.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAAGAAGAGGATATGGAA |
| Amino acid length |
295 |
| Molecular weight |
32.7 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear dots;
spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
| Microscope used for
observation |
Leica |