Gene name |
SPBC1289.02c |
Gene ID |
32/G04 |
Gene synonyms/obsolete |
uap2 |
Gene product |
U2 snRNA-associated
protein; involved in mRNA splicing; RNA-binding protein; rrm
RNA recognition motif |
Entry clone |
Cloned |
ORF length (unspliced) |
1277 |
ORF length (spliced) |
1104 |
Entry clone length |
1277 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
756T:C / 868G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1289.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCAGCCAGCCTTTTTG |
Rev primer name |
SPBC1289.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTAGAATTTTCTAACCAA |
Amino acid length |
367 |
Molecular weight |
41.9 |
Isoelectric point (calc.) |
4.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |