| Gene name |
SPBC18H10.04c |
| Gene ID |
33/A03 |
| Gene synonyms/obsolete |
sce3 |
| Gene product |
RNA-binding protein;
rrm RNA recognition motif; suppressor of cdc11 septation
defect |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1409 |
| ORF length (spliced) |
1167 |
| Entry clone length |
1409 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
353A:G / 827T:C /
1102T:A / 1148T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC18H10.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCAAGTTGTGTTTTTG |
| Rev primer name |
SPBC18H10.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTGTTTACGGCCTTTGCCA |
| Amino acid length |
388 |
| Molecular weight |
42.5 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
DeltaVision |