| Gene name |
SPBC4B4.13c |
| Gene ID |
33/B07 |
| Gene synonyms/obsolete |
liz1;
SPBC2G2.01c |
| Gene product |
transporter; unknown
specificity; required for normal cell division when
ribonucleotide reductase is inhibited |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1545 |
| ORF length (spliced) |
|
| Entry clone length |
1545 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
672T:C / 1229T:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC4B4.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCGTTACTAAATAGGTT |
| Rev primer name |
SPBC4B4.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTTGGGCATTCGTTTCT |
| Amino acid length |
514 |
| Molecular weight |
57.9 |
| Isoelectric point (calc.) |
9 |
| Signal SEQ |
|
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNKVEQKLLI/LFIIDGILTI |
| Localization (YFP) |
Golgi; periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |