| Gene name |
SPAC683.01c |
| Gene ID |
33/B12 |
| Gene synonyms/obsolete |
SPAC25B8.19c |
| Gene product |
conserved
hypothetical; zinc finger protein; zf-C2H2 type; zinc finger
protein; zf-C2H2 type; similar to Sp SPAC3H1.11 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1569 |
| ORF length (spliced) |
|
| Entry clone length |
1569 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
46A:G / 384A:G /
517G:deletion / 518C:deletion / 519A:deletion |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC683.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCTCAGATAACACTCC |
| Rev primer name |
SPAC683.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAACCATGAATGCGTTGA |
| Amino acid length |
522 |
| Molecular weight |
55 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots |
| Comments for localization |
bright signal |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |