| Gene name |
SPBC19C7.09c |
| Gene ID |
33/D09 |
| Gene synonyms/obsolete |
uve1; uvde |
| Gene product |
UV-endonuclease;
involved in DNA repair; involved in nucleotide-excision
repair; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1800 |
| ORF length (spliced) |
|
| Entry clone length |
1800 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
531T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19C7.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTAGGCTATTGAAACG |
| Rev primer name |
SPBC19C7.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTCATCCTCTTCTACT |
| Amino acid length |
599 |
| Molecular weight |
68.8 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
584 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSDSVKARLVL/LLPLCQELNI |
| Localization (YFP) |
nucleus;
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |