| Gene name |
SPBC36B7.01 |
| Gene ID |
33/D11 |
| Gene synonyms/obsolete |
SPBC19G7.17 |
| Gene product |
translocon; involved
in protein-ER targeting; similar to Sp sec61 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1813 |
| ORF length (spliced) |
1428 |
| Entry clone length |
1813 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
1002T:deletion |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC36B7.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCGGAGGTAAGTTATC |
| Rev primer name |
SPBC36B7.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTACCATTACCAAGAGAT |
| Amino acid length |
475 |
| Molecular weight |
52.4 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
9 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |