| Gene name |
SPBC409.07c |
| Gene ID |
33/D12 |
| Gene synonyms/obsolete |
spc2; wis1; smf2 |
| Gene product |
serine/threonine
protein kinase; MAP kinase kinase (MAPKK); Spc1 SAPK cascade;
involved in cell cycle progression; involved in mitotic
control; dosage dependent regulator of mitosis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1818 |
| ORF length (spliced) |
|
| Entry clone length |
1818 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
20A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC409.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCTCCAAATAATCA |
| Rev primer name |
SPBC409.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCTTCTTTTTTCACCTTTC |
| Amino acid length |
605 |
| Molecular weight |
64.7 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSCSLRQLSI |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
| Microscope used for
observation |
DeltaVision |