| Gene name |
SPBC336.12c |
| Gene ID |
33/G05 |
| Gene synonyms/obsolete |
cdc10 |
| Gene product |
DSC1/MBF trancription
factor complex; involved in start control point of mitotic
cell cycle; involved in transcriptional activation; ankyrin
repeat protein; yeast DNA-binding domain; APSES domain;
DNA-binding protein; involved in the regulation of CDK
activity; involved in control of mitosis; similar to Sp
SPBC725.16 and SPAC22F3.09c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2304 |
| ORF length (spliced) |
|
| Entry clone length |
2304 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
40A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC336.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTCAGCCAATTTTAT |
| Rev primer name |
SPBC336.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCTTGATGTTCTTTAACA |
| Amino acid length |
767 |
| Molecular weight |
85.5 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQPLISFNLDL/LEAKLSDSLDL |
| Localization (YFP) |
bright nuclear
dot |
| Comments for localization |
one large dot /cell;
aggregates |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |