| Gene name |
SPBC2G2.18 |
| Gene ID |
33/G07 |
| Gene synonyms/obsolete |
pop1;
SPBC1718.01 |
| Gene product |
F-box protein; WD
repeat protein; involved in proteolysis and peptidolysis;
forms hetero-and homo-complexes together with cullin-1 in SCF
(Skp1-Cullin-1-F-box) ubiquitin ligase; complexed with Cdc18p;
involved in the ubiquitin mediated degradation of Cdc18p;
involved in the ubiquitin mediated degradation of Cdc1p;
involved in the ubiquitin mediated degradation of Rum1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2328 |
| ORF length (spliced) |
|
| Entry clone length |
2328 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
61A:G / 672T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2G2.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGAGAAGAAAAAAGA |
| Rev primer name |
SPBC2G2.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAAGATTTAGTAGATCCA |
| Amino acid length |
775 |
| Molecular weight |
87.8 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LENLQNLLYL/LVRDLLTDLDI |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |