| Gene name |
SPBC1718.06 |
| Gene ID |
33/H10 |
| Gene synonyms/obsolete |
msp1 |
| Gene product |
involved in
mitochondrial DNA maintenance (required); human homolog OPA1
is mutated in dominant optic atrophy; dynamin family; GTPase;
interacts physically with Nim1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2712 |
| ORF length (spliced) |
|
| Entry clone length |
2712 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
398C:T / 1272A:G /
1626G:A / 2705G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1718.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAATTAGCTGGTTTTT |
| Rev primer name |
SPBC1718.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCGCTATCGGCTTGCTGT |
| Amino acid length |
903 |
| Molecular weight |
101.9 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPEISMPLWL/LQKINSLVI |
| Localization (YFP) |
vacuole membrane |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |