| Gene name |
SPBC12C2.02c |
| Gene ID |
34/A11 |
| Gene synonyms/obsolete |
ste16 |
| Gene product |
WD repeat protein;
involved in conjugation (required); involved in meiosis
(required); regulates cell cycle progression under starvation
through Rum1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3930 |
| ORF length (spliced) |
|
| Entry clone length |
3930 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
543T:C / 1919C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC12C2.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACCTGTGCGAAGGGG |
| Rev primer name |
SPBC12C2.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCGGAAATTGACAAATTA |
| Amino acid length |
1309 |
| Molecular weight |
147.4 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLFIFLELGL/LGEIGSPLLL/LSFVSNLKI |
| Localization (YFP) |
periphery at site of
septum formation; cytoplasmic dots; cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |