Gene name |
SPBC19C7.02 |
Gene ID |
34/B12 |
Gene synonyms/obsolete |
ubr1;
SPBC32F12.14 |
Gene product |
ubiquitin ligase (E3);
N-end-recognizing protein; zinc finger protein; zf-C3HC4 type
(RING finger); zf-UBR1 type; similar to Sp ubr11 |
Entry clone |
Cloned |
ORF length (unspliced) |
5877 |
ORF length (spliced) |
|
Entry clone length |
5877 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
787A:G /
1511T:deletion/ 2294C:T / 5394T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC19C7.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTACAAGACGAGTCTAG |
Rev primer name |
SPBC19C7.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGTGTTTCCCAACCTCCG |
Amino acid length |
1958 |
Molecular weight |
225.7 |
Isoelectric point (calc.) |
6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |