| Gene name |
SPCC1840.02c |
| Gene ID |
34/B11 |
| Gene synonyms/obsolete |
bgs4 |
| Gene product |
1,3-beta-glucan
synthase subunit; glycosyl transferase family 48; involved in
cell wall biosynthesis; similar to Sp SPAC24C9.07c and
SPBC19G7.05c and SPAC19B12.03 |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
5868 |
| ORF length (spliced) |
|
| Entry clone length |
5868 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1840.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGGAAATAATGAAAA |
| Rev primer name |
SPCC1840.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTAAGTGGTATTGAATTCG |
| Amino acid length |
1955 |
| Molecular weight |
225.1 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
16 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
322/316 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVIFLILII |
| Localization (YFP) |
ER; cytoplasmic
dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |