Gene name |
SPAC9.03c |
Gene ID |
34/C06 |
Gene synonyms/obsolete |
brr2 |
Gene product |
U5 snRNP-specific
protein; DEAD/DEAH box helicase; RNA helicase; helicase
C-terminal domain; AAA family ATPase; Sec63 domain; involved
in mRNA splicing; complexed with Cdc5p |
Entry clone |
Cloned |
ORF length (unspliced) |
6531 |
ORF length (spliced) |
|
Entry clone length |
6531 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
945T:C / 4316A:G /
4446C:T / 5630A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC9.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGAGTGCACATCCTAA |
Rev primer name |
SPAC9.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCCCCGTCTTCCATTTCT |
Amino acid length |
2176 |
Molecular weight |
248.8 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSLMNQQLPI |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |